Transcript: Mouse XM_006532976.2

PREDICTED: Mus musculus notchless homolog 1 (Drosophila) (Nle1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nle1 (217011)
Length:
1209
CDS:
90..938

Additional Resources:

NCBI RefSeq record:
XM_006532976.2
NBCI Gene record:
Nle1 (217011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376096 ACGTCCACGATGCTGAGATTG pLKO_005 277 CDS 100% 10.800 15.120 N Nle1 n/a
2 TRCN0000376033 GGCACTGGGTCCTTAGCATAT pLKO_005 556 CDS 100% 10.800 15.120 N Nle1 n/a
3 TRCN0000109873 ACACCGCACTTCACATGCAAA pLKO.1 528 CDS 100% 4.950 3.465 N Nle1 n/a
4 TRCN0000109872 GCTTCTATATTCTGCTTCCCA pLKO.1 863 CDS 100% 0.750 0.525 N Nle1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08383 pDONR223 100% 51.3% 54% None (many diffs) n/a
2 ccsbBroad304_08383 pLX_304 0% 51.3% 54% V5 (many diffs) n/a
Download CSV