Transcript: Mouse XM_006533168.1

PREDICTED: Mus musculus wingless-type MMTV integration site family, member 3 (Wnt3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wnt3 (22415)
Length:
1377
CDS:
288..1040

Additional Resources:

NCBI RefSeq record:
XM_006533168.1
NBCI Gene record:
Wnt3 (22415)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533168.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071499 CCAAGAGTGTATTCGCATCTA pLKO.1 998 CDS 100% 4.950 6.930 N Wnt3 n/a
2 TRCN0000033383 CCACAACACGAGGACGGAGAA pLKO.1 926 CDS 100% 1.350 1.890 N WNT3 n/a
3 TRCN0000071498 CGGCTGTGACTCACATCATAA pLKO.1 389 CDS 100% 13.200 9.240 N Wnt3 n/a
4 TRCN0000071500 GCTATGAACAAGCACAACAAT pLKO.1 525 CDS 100% 5.625 3.938 N Wnt3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533168.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12922 pDONR223 100% 52% 56.3% None (many diffs) n/a
2 ccsbBroad304_12922 pLX_304 0% 52% 56.3% V5 (many diffs) n/a
3 TRCN0000478391 CTGCCTAATTGCGACCAGTAACCA pLX_317 25.3% 52% 56.3% V5 (many diffs) n/a
Download CSV