Transcript: Mouse XM_006533204.4

PREDICTED: Mus musculus IKAROS family zinc finger 3 (Ikzf3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ikzf3 (22780)
Length:
3914
CDS:
69..1538

Additional Resources:

NCBI RefSeq record:
XM_006533204.4
NBCI Gene record:
Ikzf3 (22780)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533204.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238756 GTAACCTCCTCCGTCATATTA pLKO_005 487 CDS 100% 15.000 21.000 N Ikzf3 n/a
2 TRCN0000238754 GCGACAGAGATGAGAACATTA pLKO_005 208 CDS 100% 13.200 18.480 N Ikzf3 n/a
3 TRCN0000238757 GTGCTTGCCAAGCTCATATTT pLKO_005 2975 3UTR 100% 15.000 10.500 N Ikzf3 n/a
4 TRCN0000238758 ACGTCCTCTTCCTAGATTATG pLKO_005 1381 CDS 100% 13.200 9.240 N Ikzf3 n/a
5 TRCN0000238755 CAACGTCTTGATGGTTCATAA pLKO_005 401 CDS 100% 13.200 7.920 N Ikzf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533204.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02684 pDONR223 100% 83.3% 84% None (many diffs) n/a
2 ccsbBroad304_02684 pLX_304 0% 83.3% 84% V5 (many diffs) n/a
3 TRCN0000491596 GGATACATCCTATAATGTGCATTA pLX_317 27.1% 83.3% 84% V5 (many diffs) n/a
Download CSV