Transcript: Mouse XM_006533550.3

PREDICTED: Mus musculus post-GPI attachment to proteins 3 (Pgap3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pgap3 (320655)
Length:
2200
CDS:
93..839

Additional Resources:

NCBI RefSeq record:
XM_006533550.3
NBCI Gene record:
Pgap3 (320655)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533550.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184722 CCATTTCGACTACGGCTACAA pLKO.1 527 CDS 100% 4.950 6.930 N Pgap3 n/a
2 TRCN0000184025 CACATATCCTACCTGAGCCTT pLKO.1 504 CDS 100% 2.640 3.696 N Pgap3 n/a
3 TRCN0000196132 GAGATGAACATGCACCGGATA pLKO.1 1575 3UTR 100% 4.050 3.240 N Pgap3 n/a
4 TRCN0000184795 CCCTTTGCACTCCACTCAAAT pLKO.1 1757 3UTR 100% 13.200 9.240 N Pgap3 n/a
5 TRCN0000217898 GACTGCAAGTATGAGTGTATG pLKO.1 75 5UTR 100% 10.800 7.560 N Pgap3 n/a
6 TRCN0000216748 GTCATCCTGCATTCTGTTTAC pLKO.1 399 CDS 100% 10.800 7.560 N Pgap3 n/a
7 TRCN0000179921 CCTGGTTCTTTATCTTGGGAT pLKO.1 1873 3UTR 100% 2.640 1.848 N Pgap3 n/a
8 TRCN0000216660 CCATGTTCAAGCTGGACTAAA pLKO.1 820 CDS 100% 13.200 7.920 N Pgap3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533550.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04598 pDONR223 100% 67.1% 66.8% None (many diffs) n/a
2 ccsbBroad304_04598 pLX_304 0% 67.1% 66.8% V5 (many diffs) n/a
3 TRCN0000465222 ACGCATCCCATACATCCGCCCGGC pLX_317 22.3% 67.1% 66.8% V5 (many diffs) n/a
Download CSV