Transcript: Mouse XM_006533803.2

PREDICTED: Mus musculus golgi SNAP receptor complex member 2 (Gosr2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gosr2 (56494)
Length:
2962
CDS:
81..578

Additional Resources:

NCBI RefSeq record:
XM_006533803.2
NBCI Gene record:
Gosr2 (56494)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115093 CGTGTCGACCAGCTAAAGTAT pLKO.1 285 CDS 100% 5.625 7.875 N Gosr2 n/a
2 TRCN0000320330 CGTGTCGACCAGCTAAAGTAT pLKO_005 285 CDS 100% 5.625 7.875 N Gosr2 n/a
3 TRCN0000115095 TCAGAAGAAGATCCTTGACAT pLKO.1 422 CDS 100% 4.950 6.930 N Gosr2 n/a
4 TRCN0000320331 TCAGAAGAAGATCCTTGACAT pLKO_005 422 CDS 100% 4.950 6.930 N Gosr2 n/a
5 TRCN0000060489 CAGAAGAAGATCCTTGACATT pLKO.1 423 CDS 100% 4.950 3.960 N GOSR2 n/a
6 TRCN0000379722 AGCAAGCATAGAGCAAATATT pLKO_005 194 CDS 100% 15.000 10.500 N Gosr2 n/a
7 TRCN0000381998 CAAGCAAGGAGCCCTTGAATA pLKO_005 244 CDS 100% 13.200 9.240 N Gosr2 n/a
8 TRCN0000218114 AGAAGAAGATCCTTGACATTG pLKO_005 424 CDS 100% 10.800 7.560 N GOSR2 n/a
9 TRCN0000381197 TCTCGCACCTTCACCACTAAC pLKO_005 396 CDS 100% 10.800 7.560 N Gosr2 n/a
10 TRCN0000115091 CCCTTGAAACATATTAGCAAT pLKO.1 1405 3UTR 100% 4.950 3.465 N Gosr2 n/a
11 TRCN0000115092 GCTCACTTGTGCAGTCATGTT pLKO.1 533 CDS 100% 4.950 3.465 N Gosr2 n/a
12 TRCN0000320332 GCTCACTTGTGCAGTCATGTT pLKO_005 533 CDS 100% 4.950 3.465 N Gosr2 n/a
13 TRCN0000115094 CATTGCTAACATGCTCGGCTT pLKO.1 440 CDS 100% 2.160 1.512 N Gosr2 n/a
14 TRCN0000320255 CATTGCTAACATGCTCGGCTT pLKO_005 440 CDS 100% 2.160 1.512 N Gosr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02200 pDONR223 100% 69.1% 70.2% None (many diffs) n/a
2 ccsbBroad304_02200 pLX_304 0% 69.1% 70.2% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000474841 AGGTGTTCTGTGTGTATCATATAT pLX_317 68.7% 69.1% 70.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV