Transcript: Mouse XM_006533823.2

PREDICTED: Mus musculus SAP30 binding protein (Sap30bp), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sap30bp (57230)
Length:
2070
CDS:
59..937

Additional Resources:

NCBI RefSeq record:
XM_006533823.2
NBCI Gene record:
Sap30bp (57230)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533823.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239989 TTGCAATTTATGCGGAATATT pLKO_005 90 CDS 100% 15.000 21.000 N LOC639905 n/a
2 TRCN0000374666 CCGCCTGGCAGATGTTCAAAT pLKO_005 377 CDS 100% 13.200 18.480 N Sap30bp n/a
3 TRCN0000374729 CGTGCTCATTCCCAGTGTATG pLKO_005 1345 3UTR 100% 10.800 15.120 N Sap30bp n/a
4 TRCN0000313182 GGTCTGAAGACTCCTACTATG pLKO_005 582 CDS 100% 10.800 8.640 N Sap30bp n/a
5 TRCN0000313184 ATTCCAGCCGGAAGGACATTA pLKO_005 1091 3UTR 100% 13.200 9.240 N Sap30bp n/a
6 TRCN0000239991 CAACATGTCACCCGATGAAAT pLKO_005 340 CDS 100% 13.200 9.240 N LOC639905 n/a
7 TRCN0000099470 CCTCAACAATTCACAACAATT pLKO.1 1445 3UTR 100% 13.200 9.240 N Sap30bp n/a
8 TRCN0000313183 CTTGCAATTTATGCGGAATAT pLKO_005 89 CDS 100% 13.200 9.240 N Sap30bp n/a
9 TRCN0000179157 GACTCCTACTATGAGGCATTA pLKO.1 590 CDS 100% 10.800 7.560 N SAP30BP n/a
10 TRCN0000099472 CCAGAAGATTGAAATGGACAA pLKO.1 619 CDS 100% 4.050 2.835 N Sap30bp n/a
11 TRCN0000239990 GGACTACAGTCCAGTAGCTTC pLKO_005 990 3UTR 100% 4.050 2.835 N LOC639905 n/a
12 TRCN0000099474 GAGGAGAAAGGTGGTTTGGTA pLKO.1 164 CDS 100% 3.000 2.100 N Sap30bp n/a
13 TRCN0000363653 GAGGAGAAAGGTGGTTTGGTA pLKO_005 164 CDS 100% 3.000 2.100 N Sap30bp n/a
14 TRCN0000099471 CGGAATATTCAGACCCTGAAT pLKO.1 102 CDS 100% 0.495 0.347 N Sap30bp n/a
15 TRCN0000099473 GCACCAACTACCCAAAGGATA pLKO.1 543 CDS 100% 4.950 2.970 N Sap30bp n/a
16 TRCN0000180784 GCACCAACTACCCAAAGGATA pLKO.1 543 CDS 100% 4.950 2.970 N SAP30BP n/a
17 TRCN0000280873 GCACCAACTACCCAAAGGATA pLKO_005 543 CDS 100% 4.950 2.970 N SAP30BP n/a
18 TRCN0000312224 GCACCAACTACCCAAAGGATA pLKO_005 543 CDS 100% 4.950 2.970 N Sap30bp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533823.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03082 pDONR223 100% 84.6% 90.5% None (many diffs) n/a
2 ccsbBroad304_03082 pLX_304 0% 84.6% 90.5% V5 (many diffs) n/a
3 TRCN0000467101 GTCAGCAAGTATGTGTCTGACAGT pLX_317 32% 84.6% 90.5% V5 (many diffs) n/a
Download CSV