Transcript: Mouse XM_006533824.1

PREDICTED: Mus musculus SAP30 binding protein (Sap30bp), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sap30bp (57230)
Length:
2048
CDS:
322..915

Additional Resources:

NCBI RefSeq record:
XM_006533824.1
NBCI Gene record:
Sap30bp (57230)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533824.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239989 TTGCAATTTATGCGGAATATT pLKO_005 130 5UTR 100% 15.000 21.000 N LOC639905 n/a
2 TRCN0000374666 CCGCCTGGCAGATGTTCAAAT pLKO_005 355 CDS 100% 13.200 18.480 N Sap30bp n/a
3 TRCN0000374729 CGTGCTCATTCCCAGTGTATG pLKO_005 1323 3UTR 100% 10.800 15.120 N Sap30bp n/a
4 TRCN0000313182 GGTCTGAAGACTCCTACTATG pLKO_005 560 CDS 100% 10.800 8.640 N Sap30bp n/a
5 TRCN0000313184 ATTCCAGCCGGAAGGACATTA pLKO_005 1069 3UTR 100% 13.200 9.240 N Sap30bp n/a
6 TRCN0000239991 CAACATGTCACCCGATGAAAT pLKO_005 318 5UTR 100% 13.200 9.240 N LOC639905 n/a
7 TRCN0000099470 CCTCAACAATTCACAACAATT pLKO.1 1423 3UTR 100% 13.200 9.240 N Sap30bp n/a
8 TRCN0000313183 CTTGCAATTTATGCGGAATAT pLKO_005 129 5UTR 100% 13.200 9.240 N Sap30bp n/a
9 TRCN0000179157 GACTCCTACTATGAGGCATTA pLKO.1 568 CDS 100% 10.800 7.560 N SAP30BP n/a
10 TRCN0000099472 CCAGAAGATTGAAATGGACAA pLKO.1 597 CDS 100% 4.050 2.835 N Sap30bp n/a
11 TRCN0000239990 GGACTACAGTCCAGTAGCTTC pLKO_005 968 3UTR 100% 4.050 2.835 N LOC639905 n/a
12 TRCN0000099471 CGGAATATTCAGACCCTGAAT pLKO.1 142 5UTR 100% 0.495 0.347 N Sap30bp n/a
13 TRCN0000099473 GCACCAACTACCCAAAGGATA pLKO.1 521 CDS 100% 4.950 2.970 N Sap30bp n/a
14 TRCN0000180784 GCACCAACTACCCAAAGGATA pLKO.1 521 CDS 100% 4.950 2.970 N SAP30BP n/a
15 TRCN0000280873 GCACCAACTACCCAAAGGATA pLKO_005 521 CDS 100% 4.950 2.970 N SAP30BP n/a
16 TRCN0000312224 GCACCAACTACCCAAAGGATA pLKO_005 521 CDS 100% 4.950 2.970 N Sap30bp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533824.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03082 pDONR223 100% 58.1% 62.9% None (many diffs) n/a
2 ccsbBroad304_03082 pLX_304 0% 58.1% 62.9% V5 (many diffs) n/a
3 TRCN0000467101 GTCAGCAAGTATGTGTCTGACAGT pLX_317 32% 58.1% 62.9% V5 (many diffs) n/a
Download CSV