Transcript: Mouse XM_006533896.3

PREDICTED: Mus musculus START domain containing 3 (Stard3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stard3 (59045)
Length:
2034
CDS:
144..1484

Additional Resources:

NCBI RefSeq record:
XM_006533896.3
NBCI Gene record:
Stard3 (59045)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533896.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105331 CTCTGGATCATCGAGCTAAAT pLKO.1 345 CDS 100% 13.200 9.240 N Stard3 n/a
2 TRCN0000105333 TCTCTGGATCATCGAGCTAAA pLKO.1 344 CDS 100% 10.800 7.560 N Stard3 n/a
3 TRCN0000105330 AGCCAGAAAGTGGAACTGTTT pLKO.1 1535 3UTR 100% 4.950 3.465 N Stard3 n/a
4 TRCN0000105334 CCATGGCAAGACCTTCATCTT pLKO.1 980 CDS 100% 4.950 3.465 N Stard3 n/a
5 TRCN0000155552 CCAGTGCATTCCTCATTGTCA pLKO.1 538 CDS 100% 3.000 2.100 N STARD3 n/a
6 TRCN0000105332 GTCTGGATTCTTAACACAGAT pLKO.1 1353 CDS 100% 4.950 2.970 N Stard3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533896.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15734 pDONR223 0% 88.2% 93.4% None (many diffs) n/a
2 ccsbBroad304_15734 pLX_304 0% 88.2% 93.4% V5 (many diffs) n/a
3 TRCN0000468040 CTAAGGAAATATCTCCTATTACTT pLX_317 34.7% 88.2% 93.4% V5 (many diffs) n/a
4 ccsbBroadEn_15735 pDONR223 0% 88.2% 93.2% None (many diffs) n/a
5 ccsbBroad304_15735 pLX_304 0% 88.2% 93.2% V5 (many diffs) n/a
6 TRCN0000470662 TGTCAAACGCATTTCTTCACGCTT pLX_317 32.6% 88.2% 93.2% V5 (many diffs) n/a
7 ccsbBroadEn_07713 pDONR223 100% 88.2% 93.2% None (many diffs) n/a
8 ccsbBroad304_07713 pLX_304 0% 88.2% 93.2% V5 (many diffs) n/a
9 TRCN0000470831 GTTGAAGCGACTACGGCTACTTCT pLX_317 34.7% 88.2% 93.2% V5 (many diffs) n/a
Download CSV