Transcript: Mouse XM_006533902.3

PREDICTED: Mus musculus F-box protein 39 (Fbxo39), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxo39 (628100)
Length:
1848
CDS:
309..1640

Additional Resources:

NCBI RefSeq record:
XM_006533902.3
NBCI Gene record:
Fbxo39 (628100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533902.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255123 AGTCGGCACTGTGGTACATTA pLKO_005 535 CDS 100% 13.200 18.480 N Fbxo39 n/a
2 TRCN0000267561 GACAGGACCCTACGGGAAATT pLKO_005 1551 CDS 100% 13.200 9.240 N Fbxo39 n/a
3 TRCN0000281430 TCCGGACCATGAACATCAAAT pLKO_005 1063 CDS 100% 13.200 9.240 N Fbxo39 n/a
4 TRCN0000255121 TCGATTCAGAACTTAACTATT pLKO_005 1594 CDS 100% 13.200 9.240 N Fbxo39 n/a
5 TRCN0000255122 TAGATGCACTTTGAACCTGAA pLKO_005 1666 3UTR 100% 4.050 2.835 N Fbxo39 n/a
6 TRCN0000137726 GAACCCTTACAATGCCGTCAT pLKO.1 599 CDS 100% 4.050 2.835 N WDR46 n/a
7 TRCN0000156599 GATACCTGGAACACTTGGACA pLKO.1 568 CDS 100% 2.640 1.848 N LOC541473 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533902.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09743 pDONR223 100% 83.8% 34% None (many diffs) n/a
2 ccsbBroad304_09743 pLX_304 0% 83.8% 34% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000470964 CTTGCCCTGACAGATACCACTACT pLX_317 36.5% 83.8% 34% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV