Transcript: Mouse XM_006533919.2

PREDICTED: Mus musculus RIKEN cDNA 0610009B22 gene (0610009B22Rik), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
0610009B22Rik (66050)
Length:
883
CDS:
194..616

Additional Resources:

NCBI RefSeq record:
XM_006533919.2
NBCI Gene record:
0610009B22Rik (66050)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533919.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108621 CGTCTACGACTTATACATCAA pLKO.1 496 CDS 100% 4.950 6.930 N 0610009B22Rik n/a
2 TRCN0000335100 CGTCTACGACTTATACATCAA pLKO_005 496 CDS 100% 4.950 6.930 N 0610009B22Rik n/a
3 TRCN0000108620 GCAGTGGATGTATTGTAAATT pLKO.1 655 3UTR 100% 15.000 12.000 N 0610009B22Rik n/a
4 TRCN0000335101 GCAGTGGATGTATTGTAAATT pLKO_005 655 3UTR 100% 15.000 12.000 N 0610009B22Rik n/a
5 TRCN0000108624 GCACGAGGATGGCATCAAGAA pLKO.1 463 CDS 100% 4.950 3.465 N 0610009B22Rik n/a
6 TRCN0000335176 GCACGAGGATGGCATCAAGAA pLKO_005 463 CDS 100% 4.950 3.465 N 0610009B22Rik n/a
7 TRCN0000018937 CGTCATCTGAACCAGTTCATA pLKO.1 296 CDS 100% 5.625 3.375 N TRAPPC2 n/a
8 TRCN0000108622 CATGTGGCTCTCCAACAACAT pLKO.1 349 CDS 100% 4.950 2.970 N 0610009B22Rik n/a
9 TRCN0000335099 CATGTGGCTCTCCAACAACAT pLKO_005 349 CDS 100% 4.950 2.970 N 0610009B22Rik n/a
10 TRCN0000108623 GCCACCATGATAATCCGGTTT pLKO.1 225 CDS 100% 4.050 2.430 N 0610009B22Rik n/a
11 TRCN0000018938 CCAATTCTCCTATTCGATCAA pLKO.1 543 CDS 100% 4.950 2.970 N TRAPPC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533919.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10496 pDONR223 100% 86.9% 95% None (many diffs) n/a
2 ccsbBroad304_10496 pLX_304 0% 86.9% 95% V5 (many diffs) n/a
3 TRCN0000480983 GCTGGTTCCAAGATTCGAACTATC pLX_317 100% 86.9% 95% V5 (many diffs) n/a
Download CSV