Transcript: Mouse XM_006534019.3

PREDICTED: Mus musculus LIM domain containing 2 (Limd2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Limd2 (67803)
Length:
1750
CDS:
725..1111

Additional Resources:

NCBI RefSeq record:
XM_006534019.3
NBCI Gene record:
Limd2 (67803)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534019.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112948 GCTGCAATGCACGGTGAATTT pLKO.1 965 CDS 100% 13.200 18.480 N Limd2 n/a
2 TRCN0000112949 GTTTGGTCGTAAACAGCACAA pLKO.1 1042 CDS 100% 4.050 5.670 N Limd2 n/a
3 TRCN0000112946 GCGGTCTAAGTCCTTTAGCTT pLKO.1 802 CDS 100% 3.000 4.200 N Limd2 n/a
4 TRCN0000112947 GCTGTTTAAGAGTAAAGGCAA pLKO.1 1009 CDS 100% 2.640 1.848 N Limd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534019.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04223 pDONR223 100% 89% 95.3% None (many diffs) n/a
2 ccsbBroad304_04223 pLX_304 0% 89% 95.3% V5 (many diffs) n/a
3 TRCN0000466800 CTACGCCTAACAATAGCTAGTCAG pLX_317 68.5% 89% 95.3% V5 (many diffs) n/a
Download CSV