Transcript: Mouse XM_006534043.3

PREDICTED: Mus musculus 5'-nucleotidase, cytosolic IIIB (Nt5c3b), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nt5c3b (68106)
Length:
1634
CDS:
238..1023

Additional Resources:

NCBI RefSeq record:
XM_006534043.3
NBCI Gene record:
Nt5c3b (68106)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534043.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246420 TGCCCTTCTTCCCACAATATT pLKO_005 403 CDS 100% 15.000 21.000 N Nt5c3b n/a
2 TRCN0000194081 GAACATTCTCAAGATCGGCTT pLKO.1 972 CDS 100% 2.160 1.728 N Nt5c3b n/a
3 TRCN0000246419 GAGCTCTTTCACCACTATTAT pLKO_005 472 CDS 100% 15.000 10.500 N Nt5c3b n/a
4 TRCN0000257533 GATGCTCAGGGAGGGCTATAA pLKO_005 633 CDS 100% 13.200 9.240 N Nt5c3b n/a
5 TRCN0000246421 GCAAGCTCACCCACACCTAAA pLKO_005 1072 3UTR 100% 10.800 7.560 N Nt5c3b n/a
6 TRCN0000175680 GCTCATTCACACCTACAACAA pLKO.1 831 CDS 100% 4.950 3.465 N Nt5c3b n/a
7 TRCN0000246418 CCTGCAGGTGATTTCCGATTT pLKO_005 342 CDS 100% 10.800 6.480 N Nt5c3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534043.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13046 pDONR223 100% 62.4% 64% None (many diffs) n/a
2 ccsbBroad304_13046 pLX_304 0% 62.4% 64% V5 (many diffs) n/a
3 TRCN0000473044 ACGGGCCTAAATAGGACCCCTGAT pLX_317 62% 62.4% 64% V5 (many diffs) n/a
Download CSV