Transcript: Mouse XM_006535178.3

PREDICTED: Mus musculus methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like (Mthfd2l), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mthfd2l (665563)
Length:
2036
CDS:
93..932

Additional Resources:

NCBI RefSeq record:
XM_006535178.3
NBCI Gene record:
Mthfd2l (665563)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535178.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265805 CCAAGAGTCAGCGGTATATTA pLKO_005 561 CDS 100% 15.000 21.000 N Mthfd2l n/a
2 TRCN0000265821 GGGTATTCCCAGGTTGATTAC pLKO_005 692 CDS 100% 10.800 15.120 N Mthfd2l n/a
3 TRCN0000256659 GAAATGTGTGTGACCATTATT pLKO_005 1829 3UTR 100% 15.000 10.500 N Mthfd2l n/a
4 TRCN0000256660 TCTGCAGTGAGCTCATCATAA pLKO_005 481 CDS 100% 13.200 9.240 N Mthfd2l n/a
5 TRCN0000256658 TGATGTGGGTATCAACTATAT pLKO_005 746 CDS 100% 13.200 7.920 N Mthfd2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535178.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13695 pDONR223 100% 21.5% 22.9% None (many diffs) n/a
2 ccsbBroad304_13695 pLX_304 0% 21.5% 22.9% V5 (many diffs) n/a
3 TRCN0000467739 AGTTTAGGAATAACAATACATCTC pLX_317 100% 21.5% 22.9% V5 (many diffs) n/a
Download CSV