Transcript: Mouse XM_006535408.3

PREDICTED: Mus musculus phosphodiesterase 7A (Pde7a), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pde7a (18583)
Length:
4283
CDS:
433..1311

Additional Resources:

NCBI RefSeq record:
XM_006535408.3
NBCI Gene record:
Pde7a (18583)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313087 CTGATCAGACTGCGTTATATA pLKO_005 245 5UTR 100% 15.000 21.000 N Pde7a n/a
2 TRCN0000114947 CCAGGTGTTAATCAGCCGTTT pLKO.1 631 CDS 100% 4.050 5.670 N Pde7a n/a
3 TRCN0000114949 GCGTTATATATTCGTATGCTA pLKO.1 256 5UTR 100% 3.000 4.200 N Pde7a n/a
4 TRCN0000114948 GCTTTGATATTAGCCACGGAT pLKO.1 808 CDS 100% 2.640 3.696 N Pde7a n/a
5 TRCN0000313089 ATCGTCAGACTGAGTCTATTG pLKO_005 1070 CDS 100% 10.800 8.640 N Pde7a n/a
6 TRCN0000435894 GGCCATGCACTGTTACTTAAA pLKO_005 528 CDS 100% 13.200 9.240 N PDE7A n/a
7 TRCN0000349860 TAAGAGACGTGGAGCTATTTC pLKO_005 213 5UTR 100% 13.200 9.240 N Pde7a n/a
8 TRCN0000428622 TTTGGGTGTGAGTCCACTTTG pLKO_005 1047 CDS 100% 10.800 7.560 N PDE7A n/a
9 TRCN0000114950 CACAGTTACTAACTCAGGAAA pLKO.1 1277 CDS 100% 4.950 3.465 N Pde7a n/a
10 TRCN0000114946 GCCAGCATTATCTATCAAGAT pLKO.1 1415 3UTR 100% 4.950 3.465 N Pde7a n/a
11 TRCN0000312054 GCCAGCATTATCTATCAAGAT pLKO_005 1415 3UTR 100% 4.950 3.465 N Pde7a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01161 pDONR223 100% 57.6% 60.3% None (many diffs) n/a
2 ccsbBroad304_01161 pLX_304 0% 57.6% 60.3% V5 (many diffs) n/a
3 TRCN0000476402 CGCGCCTGTCTGGTGGAAGGCGTC pLX_317 28.9% 57.6% 60.3% V5 (many diffs) n/a
Download CSV