Transcript: Mouse XM_006535443.3

PREDICTED: Mus musculus YTH domain family 3 (Ythdf3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ythdf3 (229096)
Length:
5146
CDS:
483..2087

Additional Resources:

NCBI RefSeq record:
XM_006535443.3
NBCI Gene record:
Ythdf3 (229096)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535443.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329407 GGCCGGATTTGGCAATGATAC pLKO_005 839 CDS 100% 10.800 15.120 N Ythdf3 n/a
2 TRCN0000329409 ACCAATGTCAGATCCATATAT pLKO_005 479 5UTR 100% 15.000 10.500 N Ythdf3 n/a
3 TRCN0000329408 CGTGTGGAGATGTCCTATTAA pLKO_005 2092 3UTR 100% 15.000 10.500 N Ythdf3 n/a
4 TRCN0000353555 GATAAGTGGAAGGGCAAATTT pLKO_005 1812 CDS 100% 15.000 10.500 N Ythdf3 n/a
5 TRCN0000365164 GATAAGTGGAAGGGCAAATTT pLKO_005 1812 CDS 100% 15.000 10.500 N YTHDF3 n/a
6 TRCN0000329410 CAATAACCAATTACGACATAT pLKO_005 1865 CDS 100% 13.200 9.240 N Ythdf3 n/a
7 TRCN0000172353 CAAGTGGATCTCAGGGACAAT pLKO.1 742 CDS 100% 4.950 3.465 N YTHDF3 n/a
8 TRCN0000191462 CCAATAACCAATTACGACATA pLKO.1 1864 CDS 100% 4.950 3.465 N Ythdf3 n/a
9 TRCN0000190476 GCAGCTTATCGTTCCCTGAAT pLKO.1 1677 CDS 100% 4.950 3.465 N Ythdf3 n/a
10 TRCN0000191772 GCCTAATAAGTCAAAGAAGAT pLKO.1 2146 3UTR 100% 4.950 3.465 N Ythdf3 n/a
11 TRCN0000190961 CCAACTTCTTGGGCTGCTATT pLKO.1 1032 CDS 100% 10.800 5.400 Y Ythdf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535443.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05293 pDONR223 100% 87.8% 90.2% None (many diffs) n/a
2 ccsbBroad304_05293 pLX_304 0% 87.8% 90.2% V5 (many diffs) n/a
3 TRCN0000473510 CAGACAGTATCCGGGCATGGCAGC pLX_317 29.8% 87.8% 90.2% V5 (many diffs) n/a
Download CSV