Transcript: Mouse XM_006535472.4

PREDICTED: Mus musculus solute carrier family 7 (cationic amino acid transporter, y+ system), member 14 (Slc7a14), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Slc7a14 (241919)
Length:
8721
CDS:
224..2539

Additional Resources:

NCBI RefSeq record:
XM_006535472.4
NBCI Gene record:
Slc7a14 (241919)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535472.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157424 GATGTCAGATGCGAAGGCAAA pLKO.1 2422 CDS 100% 4.050 3.240 N SLC7A14 n/a
2 TRCN0000217335 GAGAGTGAGCATGGGTTATAT pLKO.1 4704 3UTR 100% 15.000 10.500 N Slc7a14 n/a
3 TRCN0000173233 CACGTGCTTCTATGCTTTCAT pLKO.1 1000 CDS 100% 5.625 3.938 N Slc7a14 n/a
4 TRCN0000176142 GCCATGTTGGTGAATATCTAT pLKO.1 2138 CDS 100% 5.625 3.938 N Slc7a14 n/a
5 TRCN0000194217 GCCTGGTTAAATTGCATCTAT pLKO.1 4516 3UTR 100% 5.625 3.938 N Slc7a14 n/a
6 TRCN0000193226 CATCTATCTCATCAAGTTGAA pLKO.1 1804 CDS 100% 4.950 3.465 N Slc7a14 n/a
7 TRCN0000174674 GTGAATATCTATCTCATGCTA pLKO.1 2147 CDS 100% 3.000 2.100 N Slc7a14 n/a
8 TRCN0000217941 GCTTTGTGGGTATGCTCATTT pLKO.1 2208 CDS 100% 13.200 7.920 N Slc7a14 n/a
9 TRCN0000157089 GAGGCCCTGATTGCAAATGAT pLKO.1 2495 CDS 100% 5.625 7.875 N SLC7A14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535472.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12398 pDONR223 100% 86.9% 92.6% None (many diffs) n/a
2 ccsbBroad304_12398 pLX_304 0% 86.9% 92.6% V5 (many diffs) n/a
Download CSV