Transcript: Mouse XM_006535490.3

PREDICTED: Mus musculus tripartite motif-containing 55 (Trim55), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trim55 (381485)
Length:
2279
CDS:
181..1530

Additional Resources:

NCBI RefSeq record:
XM_006535490.3
NBCI Gene record:
Trim55 (381485)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535490.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251293 AGGCCTCTAACCCGTACTTAC pLKO_005 347 CDS 100% 10.800 15.120 N Trim55 n/a
2 TRCN0000251289 TTCATGGATGAGCCCGAAATG pLKO_005 982 CDS 100% 10.800 8.640 N Trim55 n/a
3 TRCN0000251291 CAGAGCTCAGTGATGGTATTG pLKO_005 689 CDS 100% 10.800 7.560 N Trim55 n/a
4 TRCN0000251290 TCACGAAGCCTGTGGTCATTC pLKO_005 278 CDS 100% 10.800 7.560 N Trim55 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535490.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04413 pDONR223 100% 84.7% 86.5% None (many diffs) n/a
2 ccsbBroad304_04413 pLX_304 0% 84.7% 86.5% V5 (many diffs) n/a
3 TRCN0000473514 CAGTGGGAGGCAACCACGCAGACC pLX_317 36.4% 84.7% 86.5% V5 (many diffs) n/a
Download CSV