Transcript: Mouse XM_006535534.3

PREDICTED: Mus musculus SEC62 homolog (S. cerevisiae) (Sec62), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sec62 (69276)
Length:
2561
CDS:
584..1816

Additional Resources:

NCBI RefSeq record:
XM_006535534.3
NBCI Gene record:
Sec62 (69276)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535534.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222080 GAAGTTGGTGAACCATCTAAA pLKO.1 620 CDS 100% 13.200 10.560 N SEC62 n/a
2 TRCN0000306854 GAAGTTGGTGAACCATCTAAA pLKO_005 620 CDS 100% 13.200 10.560 N SEC62 n/a
3 TRCN0000191679 GAAATGAGAGTAGGTGTTTAT pLKO.1 1238 CDS 100% 13.200 9.240 N Sec62 n/a
4 TRCN0000222081 GAAATGAGAGTAGGTGTTTAT pLKO.1 1238 CDS 100% 13.200 9.240 N SEC62 n/a
5 TRCN0000289833 GAAATGAGAGTAGGTGTTTAT pLKO_005 1238 CDS 100% 13.200 9.240 N SEC62 n/a
6 TRCN0000293119 GAAATGAGAGTAGGTGTTTAT pLKO_005 1238 CDS 100% 13.200 9.240 N Sec62 n/a
7 TRCN0000200840 GACTTAAAGAAGGATGAGAAA pLKO.1 1457 CDS 100% 4.950 3.465 N Sec62 n/a
8 TRCN0000293057 GACTTAAAGAAGGATGAGAAA pLKO_005 1457 CDS 100% 4.950 3.465 N Sec62 n/a
9 TRCN0000201832 GCAGAAATGAGAGTAGGTGTT pLKO.1 1235 CDS 100% 4.050 2.430 N Sec62 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535534.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.