Transcript: Mouse XM_006535573.2

PREDICTED: Mus musculus ATPase, class VI, type 11B (Atp11b), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp11b (76295)
Length:
3179
CDS:
323..2926

Additional Resources:

NCBI RefSeq record:
XM_006535573.2
NBCI Gene record:
Atp11b (76295)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535573.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313619 GCTTCGTGGAGCCAGATTAAA pLKO_005 1051 CDS 100% 15.000 21.000 N Atp11b n/a
2 TRCN0000349912 TGCGGCAAGAGCTGGTATTAT pLKO_005 2008 CDS 100% 15.000 21.000 N Atp11b n/a
3 TRCN0000101886 CGTAGGAGAATGAGTGTAATT pLKO.1 2123 CDS 100% 13.200 18.480 N Atp11b n/a
4 TRCN0000317117 CGTAGGAGAATGAGTGTAATT pLKO_005 2123 CDS 100% 13.200 18.480 N Atp11b n/a
5 TRCN0000101889 CGGGAAGAGAAATTGGCTGAT pLKO.1 2366 CDS 100% 4.050 3.240 N Atp11b n/a
6 TRCN0000101888 GCCTTTACACACCTCAGAAAT pLKO.1 417 CDS 100% 13.200 9.240 N Atp11b n/a
7 TRCN0000101887 GCCAACTTGGACAGTCTCATA pLKO.1 917 CDS 100% 4.950 3.465 N Atp11b n/a
8 TRCN0000317177 GCCAACTTGGACAGTCTCATA pLKO_005 917 CDS 100% 4.950 3.465 N Atp11b n/a
9 TRCN0000049937 CCTAAATGTATAGGTGGAGAA pLKO.1 2204 CDS 100% 4.050 2.835 N ATP11B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535573.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11694 pDONR223 100% 20.6% 20.8% None (many diffs) n/a
2 ccsbBroad304_11694 pLX_304 0% 20.6% 20.8% V5 (many diffs) n/a
3 TRCN0000475285 GCTAGACGGCAGACTTCTGGGTAC pLX_317 65.2% 20.6% 20.8% V5 (many diffs) n/a
Download CSV