Transcript: Mouse XM_006535619.3

PREDICTED: Mus musculus calcium channel, voltage-dependent, alpha2/delta subunit 1 (Cacna2d1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cacna2d1 (12293)
Length:
2043
CDS:
286..1974

Additional Resources:

NCBI RefSeq record:
XM_006535619.3
NBCI Gene record:
Cacna2d1 (12293)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535619.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421331 TGACTCAGCTTGCTGATATTT pLKO_005 446 CDS 100% 15.000 10.500 N Cacna2d1 n/a
2 TRCN0000436790 AGCATGCAGCGGTCCATATTC pLKO_005 770 CDS 100% 13.200 9.240 N Cacna2d1 n/a
3 TRCN0000068996 GCTGAGTTAGAGAATGAAATT pLKO.1 2015 3UTR 100% 13.200 9.240 N Cacna2d1 n/a
4 TRCN0000068994 CCCAGGAGATATTTGCCAAAT pLKO.1 1391 CDS 100% 10.800 7.560 N Cacna2d1 n/a
5 TRCN0000068997 GCCTTAGATGAAGTATTCAAA pLKO.1 847 CDS 100% 5.625 3.938 N Cacna2d1 n/a
6 TRCN0000069649 CAAGAGATTGACACCACGTTT pLKO.1 1776 CDS 100% 4.950 3.465 N LOC384313 n/a
7 TRCN0000069648 CCAGTTGATTCTTGGTGTGAT pLKO.1 1728 CDS 100% 4.950 3.465 N LOC384313 n/a
8 TRCN0000069651 CTTGTCATTACTGGAACTCTA pLKO.1 1657 CDS 100% 4.950 3.465 N LOC384313 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535619.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.