Transcript: Mouse XM_006535700.3

PREDICTED: Mus musculus lysine (K)-specific methyltransferase 2C (Kmt2c), transcript variant X21, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kmt2c (231051)
Length:
16450
CDS:
266..14806

Additional Resources:

NCBI RefSeq record:
XM_006535700.3
NBCI Gene record:
Kmt2c (231051)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535700.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238933 AGGGCTGCTTTACGCATAAAT pLKO_005 5387 CDS 100% 15.000 21.000 N Kmt2c n/a
2 TRCN0000238937 GATAGAGCTAAGGGATAATAA pLKO_005 15319 3UTR 100% 15.000 21.000 N Kmt2c n/a
3 TRCN0000238934 GAACGTCTCCAGTAGCTAATA pLKO_005 10980 CDS 100% 13.200 18.480 N Kmt2c n/a
4 TRCN0000168341 GCATGGGTAAACCAGCTATTA pLKO.1 2721 CDS 100% 13.200 10.560 N BAGE2 n/a
5 TRCN0000238936 ATCATCAGTGAACCATAATTT pLKO_005 9295 CDS 100% 15.000 10.500 N Kmt2c n/a
6 TRCN0000238935 ATGACCCATTAGCTGATATTT pLKO_005 4521 CDS 100% 15.000 10.500 N Kmt2c n/a
7 TRCN0000368534 ATGACCCATTAGCTGATATTT pLKO_005 4521 CDS 100% 15.000 10.500 N KMT2C n/a
8 TRCN0000168695 GCAAACAATCGGGAGAAGATA pLKO.1 1446 CDS 100% 5.625 3.375 N BAGE4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535700.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.