Transcript: Mouse XM_006535818.1

PREDICTED: Mus musculus solute carrier family 26, member 5 (Slc26a5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc26a5 (80979)
Length:
4310
CDS:
188..2236

Additional Resources:

NCBI RefSeq record:
XM_006535818.1
NBCI Gene record:
Slc26a5 (80979)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102129 GTCCGGTTAGTACCAGATGAT pLKO.1 446 CDS 100% 4.950 6.930 N Slc26a5 n/a
2 TRCN0000102126 GCCGGGATTGTGAAAGAATAT pLKO.1 1982 CDS 100% 13.200 10.560 N Slc26a5 n/a
3 TRCN0000102128 CCATGTCTGTTACCTTACTTT pLKO.1 537 CDS 100% 5.625 3.938 N Slc26a5 n/a
4 TRCN0000102127 GCTGTTATTAGCTTGATGATT pLKO.1 413 CDS 100% 5.625 3.938 N Slc26a5 n/a
5 TRCN0000102125 CGCTCCTGAATTCTGGACTTA pLKO.1 2260 3UTR 100% 0.000 0.000 N Slc26a5 n/a
6 TRCN0000413075 TTGGATTTGTGGCCATATATC pLKO_005 594 CDS 100% 13.200 10.560 N SLC26A5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13637 pDONR223 100% 49.2% 54.4% None (many diffs) n/a
2 ccsbBroad304_13637 pLX_304 0% 49.2% 54.4% V5 (many diffs) n/a
3 TRCN0000470360 ACATAACCGTGCATCCTCATCGCA pLX_317 28.4% 49.2% 54.4% V5 (many diffs) n/a
Download CSV