Transcript: Mouse XM_006536223.3

PREDICTED: Mus musculus sirtuin 3 (Sirt3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sirt3 (64384)
Length:
1251
CDS:
240..851

Additional Resources:

NCBI RefSeq record:
XM_006536223.3
NBCI Gene record:
Sirt3 (64384)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006536223.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039332 GCCCAATGTCACTCACTACTT pLKO.1 428 CDS 100% 4.950 3.960 N Sirt3 n/a
2 TRCN0000332647 GCCCAATGTCACTCACTACTT pLKO_005 428 CDS 100% 4.950 3.960 N Sirt3 n/a
3 TRCN0000039330 GCGGCTCTATACACAGAACAT pLKO.1 482 CDS 100% 4.950 3.960 N Sirt3 n/a
4 TRCN0000306513 AGACAGCTCCAACACGTTTAC pLKO_005 922 3UTR 100% 10.800 7.560 N Sirt3 n/a
5 TRCN0000039333 CACAAGAACTGCTGGATCTTA pLKO.1 790 CDS 100% 5.625 3.375 N Sirt3 n/a
6 TRCN0000332648 CACAAGAACTGCTGGATCTTA pLKO_005 790 CDS 100% 5.625 3.375 N Sirt3 n/a
7 TRCN0000039329 GCCATCTTTGAACTTGGCTTT pLKO.1 345 CDS 100% 4.050 2.430 N Sirt3 n/a
8 TRCN0000332649 GCCATCTTTGAACTTGGCTTT pLKO_005 345 CDS 100% 4.050 2.430 N Sirt3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006536223.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.