Transcript: Mouse XM_006537504.1

PREDICTED: Mus musculus olfactory receptor 157 (Olfr157), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Olfr157 (100040268)
Length:
1939
CDS:
209..1165

Additional Resources:

NCBI RefSeq record:
XM_006537504.1
NBCI Gene record:
Olfr157 (100040268)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188389 CCTTAGATACCCTGTGGTCAT pLKO.1 595 CDS 100% 4.050 2.430 N Olfr157 n/a
2 TRCN0000188629 CAAGCTCATCTCCCTCTTCTA pLKO.1 1039 CDS 100% 4.950 2.475 Y Olfr157 n/a
3 TRCN0000203428 CATCTTTGTCTCCTACATCTT pLKO.1 847 CDS 100% 4.950 2.475 Y Olfr159 n/a
4 TRCN0000203152 GTTCATCTTTGTCTCCTACAT pLKO.1 844 CDS 100% 4.950 2.475 Y Olfr156 n/a
5 TRCN0000187286 CGTGCAGATGTTTCTCTCCTT pLKO.1 502 CDS 100% 2.640 1.320 Y Olfr155 n/a
6 TRCN0000188297 CGCCCATGTACTTCTTCCTAA pLKO.1 378 CDS 100% 4.950 2.475 Y Olfr281 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.