Transcript: Mouse XM_006537672.3

PREDICTED: Mus musculus pregnancy-associated plasma protein A (Pappa), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pappa (18491)
Length:
8667
CDS:
91..2880

Additional Resources:

NCBI RefSeq record:
XM_006537672.3
NBCI Gene record:
Pappa (18491)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537672.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032782 GCTGGAATTTCGCTACCCTTT pLKO.1 348 CDS 100% 4.050 5.670 N Pappa n/a
2 TRCN0000341126 GTACCGGATTATCACCATTTC pLKO_005 756 CDS 100% 0.000 0.000 N Pappa n/a
3 TRCN0000341130 ACGACATGAATAAGGTCAATG pLKO_005 878 CDS 100% 10.800 8.640 N Pappa n/a
4 TRCN0000341057 TCCGAACCTGGAGTCCAAATT pLKO_005 266 CDS 100% 13.200 9.240 N Pappa n/a
5 TRCN0000341056 TGAACCCAGCCGGTGCTATTT pLKO_005 951 CDS 100% 13.200 9.240 N Pappa n/a
6 TRCN0000032783 CCTGGAGATTGATGCAGCAAT pLKO.1 579 CDS 100% 4.950 3.465 N Pappa n/a
7 TRCN0000127737 GCTAATCAAGAGCCAGGTATT pLKO.1 1761 CDS 100% 10.800 8.640 N ANKRD12 n/a
8 TRCN0000430558 TTGGCAGTGTGTACCAGTATT pLKO_005 740 CDS 100% 13.200 7.920 N PAPPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537672.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.