Transcript: Mouse XM_006537867.2

PREDICTED: Mus musculus RIKEN cDNA 6330416G13 gene (6330416G13Rik), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem268 (230279)
Length:
3825
CDS:
405..1433

Additional Resources:

NCBI RefSeq record:
XM_006537867.2
NBCI Gene record:
Tmem268 (230279)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194520 GAGGAGGTACATCATCTACAA pLKO.1 680 CDS 100% 4.950 6.930 N Tmem268 n/a
2 TRCN0000271709 GTCAATGGGAACGCGACACAT pLKO_005 1328 CDS 100% 4.950 6.930 N Tmem268 n/a
3 TRCN0000194428 CAGCTCATAGAAGTACACGTT pLKO.1 1377 CDS 100% 2.640 3.696 N Tmem268 n/a
4 TRCN0000173953 GCTCTGGTTTGTCTACTTCGA pLKO.1 992 CDS 100% 2.640 3.696 N Tmem268 n/a
5 TRCN0000281779 GTGCTCGCTCCTAGGTCTTAA pLKO_005 3461 3UTR 100% 13.200 10.560 N Tmem268 n/a
6 TRCN0000281793 CAGAGGAAGGCCAACACTAAC pLKO_005 873 CDS 100% 10.800 8.640 N Tmem268 n/a
7 TRCN0000271763 CAGTCCTCCGGATCGACAATA pLKO_005 538 CDS 100% 13.200 9.240 N Tmem268 n/a
8 TRCN0000281830 TGACCCTTGTGCTGGTCTTTG pLKO_005 844 CDS 100% 10.800 7.560 N Tmem268 n/a
9 TRCN0000194099 GCTGCATCACTTTACTTGTAT pLKO.1 2639 3UTR 100% 5.625 3.938 N Tmem268 n/a
10 TRCN0000173990 GCCCAACATTGTACCCATCTT pLKO.1 2457 3UTR 100% 4.950 3.465 N Tmem268 n/a
11 TRCN0000173127 CAGACTGAACTCTATCAGCTT pLKO.1 1212 CDS 100% 2.640 1.848 N Tmem268 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13399 pDONR223 100% 81.3% 81.9% None (many diffs) n/a
2 ccsbBroad304_13399 pLX_304 0% 81.3% 81.9% V5 (many diffs) n/a
3 TRCN0000479222 TCAAGCATTTAAGTTGAAATTCCT pLX_317 51.4% 81.3% 81.9% V5 (many diffs) n/a
Download CSV