Transcript: Mouse XM_006538064.3

PREDICTED: Mus musculus regulator of G-protein signaling 3 (Rgs3), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rgs3 (50780)
Length:
5439
CDS:
1005..2813

Additional Resources:

NCBI RefSeq record:
XM_006538064.3
NBCI Gene record:
Rgs3 (50780)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538064.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037150 GCATACGCTTATTGGCTGCAT pLKO.1 1361 CDS 100% 2.640 3.696 N Rgs3 n/a
2 TRCN0000037151 CATTCCAGTTACGGCACCTAT pLKO.1 2277 CDS 100% 4.950 3.960 N Rgs3 n/a
3 TRCN0000432504 GAGAAGGCAGAGTGCTTATTC pLKO_005 2580 CDS 100% 13.200 9.240 N Rgs3 n/a
4 TRCN0000418614 TCCACGAGCACTTCTTCTTTC pLKO_005 1270 CDS 100% 10.800 7.560 N Rgs3 n/a
5 TRCN0000037152 CCCTAACAAGAGGGAGAAGAA pLKO.1 1874 CDS 100% 4.950 3.465 N Rgs3 n/a
6 TRCN0000037153 GAGGATACAATCCCTGAAGAA pLKO.1 2127 CDS 100% 4.950 3.465 N Rgs3 n/a
7 TRCN0000037149 CCACCTACAGAGAGGAAGAAA pLKO.1 2688 CDS 100% 5.625 3.375 N Rgs3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538064.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06862 pDONR223 100% 34.5% 33% None (many diffs) n/a
2 ccsbBroad304_06862 pLX_304 0% 34.5% 33% V5 (many diffs) n/a
3 TRCN0000468623 AGCACTGCGTGATGATGACGAAGT pLX_317 15% 34.5% 33% V5 (many diffs) n/a
Download CSV