Transcript: Mouse XM_006538107.2

PREDICTED: Mus musculus ubiquitin-conjugating enzyme E2J 1 (Ube2j1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ube2j1 (56228)
Length:
3439
CDS:
200..1036

Additional Resources:

NCBI RefSeq record:
XM_006538107.2
NBCI Gene record:
Ube2j1 (56228)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321364 ATCGGGTTTATGCCGACTAAA pLKO_005 545 CDS 100% 13.200 18.480 N Ube2j1 n/a
2 TRCN0000008442 CGACGAATATATCTGGCCAAT pLKO.1 989 CDS 100% 4.050 5.670 N Ube2j1 n/a
3 TRCN0000008439 GCTCTTATATTCCGACGAATA pLKO.1 977 CDS 100% 1.080 1.512 N Ube2j1 n/a
4 TRCN0000321362 GCTCTTATATTCCGACGAATA pLKO_005 977 CDS 100% 1.080 1.512 N Ube2j1 n/a
5 TRCN0000008441 GCTAACAGCTAATGGACGATT pLKO.1 430 CDS 100% 4.950 3.465 N Ube2j1 n/a
6 TRCN0000008440 CCATGAAACCACCAAGCATTA pLKO.1 405 CDS 100% 10.800 6.480 N Ube2j1 n/a
7 TRCN0000321361 CCATGAAACCACCAAGCATTA pLKO_005 405 CDS 100% 10.800 6.480 N Ube2j1 n/a
8 TRCN0000008438 GCTGTGACTCAGTTGCTTCAT pLKO.1 1057 3UTR 100% 4.950 2.970 N Ube2j1 n/a
9 TRCN0000321363 GCTGTGACTCAGTTGCTTCAT pLKO_005 1057 3UTR 100% 4.950 2.970 N Ube2j1 n/a
10 TRCN0000320501 ACATTCTGCATTGGGTATAAT pLKO_005 1081 3UTR 100% 15.000 10.500 N UBE2J1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08296 pDONR223 100% 77.2% 81.7% None (many diffs) n/a
2 ccsbBroad304_08296 pLX_304 0% 77.2% 81.7% V5 (many diffs) n/a
3 TRCN0000472566 AATGTGCACTTTTATTGAATTCAA pLX_317 40.2% 77.2% 81.7% V5 (many diffs) n/a
Download CSV