Transcript: Mouse XM_006538204.3

PREDICTED: Mus musculus UFM1 specific ligase 1 (Ufl1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ufl1 (67490)
Length:
4025
CDS:
642..2006

Additional Resources:

NCBI RefSeq record:
XM_006538204.3
NBCI Gene record:
Ufl1 (67490)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538204.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215678 GAGTAGAGTCAGTGATATTAT pLKO.1 21 5UTR 100% 15.000 21.000 N Ufl1 n/a
2 TRCN0000264451 TCAGCGACTTGGCCGGATTAT pLKO_005 98 5UTR 100% 13.200 18.480 N Ufl1 n/a
3 TRCN0000264453 GGTAATAGATGCAGACTTTAT pLKO_005 2133 3UTR 100% 13.200 10.560 N Ufl1 n/a
4 TRCN0000201728 GCAGACTTTATGGGAAGCTTT pLKO.1 2143 3UTR 100% 4.950 3.960 N Ufl1 n/a
5 TRCN0000215463 GAACTGTCATTATCCATTAAG pLKO.1 1941 CDS 100% 13.200 9.240 N Ufl1 n/a
6 TRCN0000283045 TCGCTTCAGCTATAGTCTTTA pLKO_005 679 CDS 100% 13.200 9.240 N Ufl1 n/a
7 TRCN0000143982 CCTGTGCATTTAATCACTGAA pLKO.1 798 CDS 100% 4.950 3.465 N UFL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538204.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07873 pDONR223 100% 49.5% 50.8% None (many diffs) n/a
2 ccsbBroad304_07873 pLX_304 0% 49.5% 50.8% V5 (many diffs) n/a
3 TRCN0000479000 TATTGACGCACACCCCGATCTATT pLX_317 19.2% 49.5% 50.8% V5 (many diffs) n/a
Download CSV