Transcript: Mouse XM_006538281.2

PREDICTED: Mus musculus zinc finger protein 618 (Zfp618), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp618 (72701)
Length:
8774
CDS:
16..2910

Additional Resources:

NCBI RefSeq record:
XM_006538281.2
NBCI Gene record:
Zfp618 (72701)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538281.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239633 TCAGAGATCCGGACCGTATAC pLKO_005 1870 CDS 100% 10.800 15.120 N Zfp618 n/a
2 TRCN0000239632 GAGTCTCCCAGAGCAACAATT pLKO_005 536 CDS 100% 13.200 9.240 N Zfp618 n/a
3 TRCN0000239635 ATGCTTTAAGACTCAACTTTG pLKO_005 2902 CDS 100% 10.800 7.560 N Zfp618 n/a
4 TRCN0000239631 CCAGCACGAGGAGATCATTAG pLKO_005 2505 CDS 100% 10.800 7.560 N Zfp618 n/a
5 TRCN0000239634 TGGGCAAGAACGAAGTCTATG pLKO_005 2651 CDS 100% 10.800 7.560 N Zfp618 n/a
6 TRCN0000138324 CAAGGAGAACTTCAAGGTGCA pLKO.1 2421 CDS 100% 2.160 1.512 N ZNF618 n/a
7 TRCN0000138804 GCTCAAGGAGAACTTCAAGGT pLKO.1 2418 CDS 100% 2.640 1.584 N ZNF618 n/a
8 TRCN0000136106 CACATCAAGAGCTATGTGCTT pLKO.1 1768 CDS 100% 0.264 0.370 N ZNF618 n/a
9 TRCN0000138879 GCCAAGAAGATGAACCTCATC pLKO.1 2197 CDS 100% 4.050 2.835 N ZNF618 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538281.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14357 pDONR223 100% 50.5% 55.2% None (many diffs) n/a
2 ccsbBroad304_14357 pLX_304 0% 50.5% 55.2% V5 (many diffs) n/a
3 TRCN0000477235 GTACTAGGTTAATTAATCAAATCG pLX_317 9.1% 50.5% 55.2% V5 (many diffs) n/a
Download CSV