Transcript: Mouse XM_006538465.3

PREDICTED: Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 8 (Ppp1r8), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp1r8 (100336)
Length:
2260
CDS:
201..1331

Additional Resources:

NCBI RefSeq record:
XM_006538465.3
NBCI Gene record:
Ppp1r8 (100336)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538465.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102569 GCTAATTGAGAAGCTGATTAT pLKO.1 386 CDS 100% 13.200 18.480 N Ppp1r8 n/a
2 TRCN0000324638 GCTAATTGAGAAGCTGATTAT pLKO_005 386 CDS 100% 13.200 18.480 N Ppp1r8 n/a
3 TRCN0000102568 CCATCGATTCTACGGTCTCAT pLKO.1 607 CDS 100% 4.950 6.930 N Ppp1r8 n/a
4 TRCN0000353859 CCATCGATTCTACGGTCTCAT pLKO_005 607 CDS 100% 4.950 6.930 N Ppp1r8 n/a
5 TRCN0000102566 GCGGATTTCAACCCTCACTAT pLKO.1 803 CDS 100% 4.950 6.930 N Ppp1r8 n/a
6 TRCN0000353929 GCGGATTTCAACCCTCACTAT pLKO_005 803 CDS 100% 4.950 6.930 N Ppp1r8 n/a
7 TRCN0000102567 CCACACCTTCCTTACTGATTT pLKO.1 1309 CDS 100% 13.200 9.240 N Ppp1r8 n/a
8 TRCN0000324701 CCACACCTTCCTTACTGATTT pLKO_005 1309 CDS 100% 13.200 9.240 N Ppp1r8 n/a
9 TRCN0000102565 CCTGGTGAACAGGAAGACTAT pLKO.1 1979 3UTR 100% 4.950 3.465 N Ppp1r8 n/a
10 TRCN0000324639 CCTGGTGAACAGGAAGACTAT pLKO_005 1979 3UTR 100% 4.950 3.465 N Ppp1r8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538465.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01261 pDONR223 100% 50% 53.5% None (many diffs) n/a
2 ccsbBroad304_01261 pLX_304 0% 50% 53.5% V5 (many diffs) n/a
3 TRCN0000465265 TCGCCCCGCTTATTGGGACAGCGC pLX_317 39.2% 50% 53.5% V5 (many diffs) n/a
Download CSV