Transcript: Mouse XM_006538517.1

PREDICTED: Mus musculus DNA fragmentation factor, beta subunit (Dffb), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dffb (13368)
Length:
1228
CDS:
133..927

Additional Resources:

NCBI RefSeq record:
XM_006538517.1
NBCI Gene record:
Dffb (13368)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222725 CCCATCCTGGTTTGAAGGTTT pLKO.1 555 CDS 100% 4.950 6.930 N Dffb n/a
2 TRCN0000304260 CATCACGTGAGCCAGAATATT pLKO_005 511 CDS 100% 15.000 10.500 N Dffb n/a
3 TRCN0000077217 ACCTGGAACCTGGATCATATA pLKO.1 904 CDS 100% 13.200 9.240 N Dffb n/a
4 TRCN0000331496 ACCTGGAACCTGGATCATATA pLKO_005 904 CDS 100% 13.200 9.240 N Dffb n/a
5 TRCN0000077214 GCAGTACAATGGCAGCTATTT pLKO.1 741 CDS 100% 13.200 9.240 N Dffb n/a
6 TRCN0000301452 GCAGTACAATGGCAGCTATTT pLKO_005 741 CDS 100% 13.200 9.240 N Dffb n/a
7 TRCN0000348937 CAAGTTGCGAGCCCTACATAG pLKO_005 165 CDS 100% 10.800 7.560 N Dffb n/a
8 TRCN0000222724 GCACGGCAACTGCTGTCAGAT pLKO.1 448 CDS 100% 1.650 1.155 N Dffb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.