Transcript: Mouse XM_006538519.3

PREDICTED: Mus musculus dishevelled segment polarity protein 1 (Dvl1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dvl1 (13542)
Length:
3320
CDS:
329..2383

Additional Resources:

NCBI RefSeq record:
XM_006538519.3
NBCI Gene record:
Dvl1 (13542)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538519.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097266 GCTTGAATCTAGCAGCTTTAT pLKO.1 883 CDS 100% 13.200 10.560 N Dvl1 n/a
2 TRCN0000305833 AGGTGAACGATGTCAACTTTG pLKO_005 1236 CDS 100% 10.800 7.560 N Dvl1 n/a
3 TRCN0000097268 ACCGTGAACAAGATCACCTTT pLKO.1 1742 CDS 100% 4.950 3.465 N Dvl1 n/a
4 TRCN0000097264 CCAGGATATTGGCTTGACATT pLKO.1 2551 3UTR 100% 4.950 3.465 N Dvl1 n/a
5 TRCN0000324649 CCAGGATATTGGCTTGACATT pLKO_005 2551 3UTR 100% 4.950 3.465 N Dvl1 n/a
6 TRCN0000097267 GCTGACTGTGAAGAGTGACAT pLKO.1 1519 CDS 100% 4.950 3.465 N Dvl1 n/a
7 TRCN0000324712 GCTGACTGTGAAGAGTGACAT pLKO_005 1519 CDS 100% 4.950 3.465 N Dvl1 n/a
8 TRCN0000437748 TGAACCTCAACAGTGGCTCCA pLKO_005 1815 CDS 100% 2.160 1.512 N DVL1 n/a
9 TRCN0000097265 CGCCTACAAATTCTTCTTCAA pLKO.1 457 CDS 100% 4.950 2.970 N Dvl1 n/a
10 TRCN0000324713 CGCCTACAAATTCTTCTTCAA pLKO_005 457 CDS 100% 4.950 2.970 N Dvl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538519.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10790 pDONR223 100% 56.3% 60.5% None (many diffs) n/a
2 ccsbBroad304_10790 pLX_304 33.6% 56.3% 60.5% V5 (many diffs) n/a
3 TRCN0000473904 TACTGAATTCCTACAGGTACCGTG pLX_317 13.3% 56.3% 60.5% V5 (many diffs) n/a
Download CSV