Transcript: Mouse XM_006538530.3

PREDICTED: Mus musculus Eph receptor A8 (Epha8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Epha8 (13842)
Length:
1457
CDS:
34..1362

Additional Resources:

NCBI RefSeq record:
XM_006538530.3
NBCI Gene record:
Epha8 (13842)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538530.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361128 GTGTCTACGCCGAGATCAAAT pLKO_005 317 CDS 100% 13.200 18.480 N Epha8 n/a
2 TRCN0000023507 ACTCCGAATCTACTACAAGAA pLKO.1 618 CDS 100% 4.950 6.930 N Epha8 n/a
3 TRCN0000023506 CTTGTTGGATACATCAACCAT pLKO.1 129 CDS 100% 3.000 2.400 N Epha8 n/a
4 TRCN0000361191 ACCTGATCTCCAGCGTAAATG pLKO_005 1031 CDS 100% 13.200 9.240 N Epha8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538530.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06170 pDONR223 100% 79.6% 84.8% None (many diffs) n/a
2 ccsbBroad304_06170 pLX_304 0% 79.6% 84.8% V5 (many diffs) n/a
3 TRCN0000470862 CCTTATTTCTCCCTATTGCCCGTC pLX_317 27.7% 79.6% 84.8% V5 (many diffs) n/a
Download CSV