Transcript: Mouse XM_006538629.1

PREDICTED: Mus musculus paired box 7 (Pax7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pax7 (18509)
Length:
5361
CDS:
116..1633

Additional Resources:

NCBI RefSeq record:
XM_006538629.1
NBCI Gene record:
Pax7 (18509)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538629.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075381 GCTGTTGATTACCTGGCCAAA pLKO.1 1520 CDS 100% 4.050 5.670 N Pax7 n/a
2 TRCN0000416366 TCCGTGTTTCCCATGGTTGTG pLKO_005 342 CDS 100% 4.050 5.670 N Pax7 n/a
3 TRCN0000425406 CCAAGATTCTGTGCCGATATC pLKO_005 366 CDS 100% 10.800 8.640 N Pax7 n/a
4 TRCN0000018277 TCAGGTTTAGTGAGTTCGATT pLKO.1 563 CDS 100% 4.950 3.960 N PAX7 n/a
5 TRCN0000075378 GCAGAGATTGAGGCTCAATTT pLKO.1 1932 3UTR 100% 13.200 9.240 N Pax7 n/a
6 TRCN0000075379 CCGTCACAAGATAGTGGAAAT pLKO.1 280 CDS 100% 10.800 7.560 N Pax7 n/a
7 TRCN0000075380 CAGAATCAAGTTCGGGAAGAA pLKO.1 595 CDS 100% 4.950 3.465 N Pax7 n/a
8 TRCN0000415157 GAAACGGGACAAGCCTACTAG pLKO_005 1613 CDS 100% 4.950 3.465 N Pax7 n/a
9 TRCN0000018273 GCTCAGAATCAAGTTCGGGAA pLKO.1 592 CDS 100% 2.160 1.512 N PAX7 n/a
10 TRCN0000075382 CGTCTGGATGAGGGCTCAGAT pLKO.1 707 CDS 100% 1.650 1.155 N Pax7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538629.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06690 pDONR223 100% 83.1% 86% None (many diffs) n/a
2 ccsbBroad304_06690 pLX_304 0% 83.1% 86% V5 (many diffs) n/a
3 TRCN0000492183 TTGATGCCCTACTATAACCCTTAC pLX_317 25.7% 83.1% 86% V5 (many diffs) n/a
Download CSV