Transcript: Mouse XM_006538668.3

PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, U (Ptpru), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptpru (19273)
Length:
5611
CDS:
206..4570

Additional Resources:

NCBI RefSeq record:
XM_006538668.3
NBCI Gene record:
Ptpru (19273)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538668.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220448 GCCTGAGATGATCTACGATTT pLKO.1 3124 CDS 100% 10.800 15.120 N Ptpru n/a
2 TRCN0000220110 CAGCTTTGATTATGCCGACAT pLKO.1 1999 CDS 100% 4.050 5.670 N PTPRU n/a
3 TRCN0000220451 CGTCATGCTGAACCAACTTAA pLKO.1 4048 CDS 100% 13.200 9.240 N Ptpru n/a
4 TRCN0000220450 CCAGGAGAAGACTCACATGAT pLKO.1 2617 CDS 100% 4.950 3.465 N Ptpru n/a
5 TRCN0000220449 CGTGCGTCTGATTCTCACAAA pLKO.1 1609 CDS 100% 4.950 3.465 N Ptpru n/a
6 TRCN0000029965 GCTCAGTATGACGACTTCCAA pLKO.1 359 CDS 100% 3.000 2.100 N Ptpru n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538668.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07547 pDONR223 100% 86.7% 91.5% None (many diffs) n/a
2 ccsbBroad304_07547 pLX_304 0% 86.7% 91.5% V5 (many diffs) n/a
Download CSV