Transcript: Mouse XM_006538703.3

PREDICTED: Mus musculus F-box protein 42 (Fbxo42), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxo42 (213499)
Length:
2291
CDS:
302..2059

Additional Resources:

NCBI RefSeq record:
XM_006538703.3
NBCI Gene record:
Fbxo42 (213499)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538703.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277424 CACACGTACTCGCCGTCTAAA pLKO_005 536 CDS 100% 13.200 18.480 N Fbxo42 n/a
2 TRCN0000277425 CGAGGCGAGCTCATCGTATTT pLKO_005 1958 CDS 100% 13.200 18.480 N Fbxo42 n/a
3 TRCN0000176730 CCATTCTCAATGGTGGAAATT pLKO.1 1215 CDS 100% 13.200 10.560 N Fbxo42 n/a
4 TRCN0000176980 GCTAGACATTAAAGACACCAA pLKO.1 1849 CDS 100% 2.640 2.112 N Fbxo42 n/a
5 TRCN0000277357 GCTAGACATTAAAGACACCAA pLKO_005 1849 CDS 100% 2.640 2.112 N Fbxo42 n/a
6 TRCN0000197775 GATGCCAATCAGTCTATGTAT pLKO.1 287 5UTR 100% 5.625 3.938 N Fbxo42 n/a
7 TRCN0000277353 TTGCTCCAGGCTGGGATTAAA pLKO_005 2185 3UTR 100% 15.000 9.000 N Fbxo42 n/a
8 TRCN0000133892 CCAGAGAGATTCTTTGATGAA pLKO.1 512 CDS 100% 4.950 2.970 N FBXO42 n/a
9 TRCN0000197975 CCTAAATAGCAAGGAGTGGAT pLKO.1 370 CDS 100% 2.640 1.584 N Fbxo42 n/a
10 TRCN0000277426 CCTAAATAGCAAGGAGTGGAT pLKO_005 370 CDS 100% 2.640 1.584 N Fbxo42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538703.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03416 pDONR223 100% 72% 77.6% None (many diffs) n/a
2 ccsbBroad304_03416 pLX_304 0% 72% 77.6% V5 (many diffs) n/a
3 TRCN0000474599 AACAGTTTTAACCTAGCCTGCTGC pLX_317 19.1% 72% 77.6% V5 (many diffs) n/a
Download CSV