Transcript: Mouse XM_006538795.2

PREDICTED: Mus musculus eukaryotic translation initiation factor 4 gamma, 3 (Eif4g3), transcript variant X31, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eif4g3 (230861)
Length:
5594
CDS:
544..5301

Additional Resources:

NCBI RefSeq record:
XM_006538795.2
NBCI Gene record:
Eif4g3 (230861)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538795.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353411 CACGCATGGACCAGTACTTTA pLKO_005 3386 CDS 100% 13.200 18.480 N Eif4g3 n/a
2 TRCN0000328220 CCTCATGATAGTCAGCTAATT pLKO_005 1582 CDS 100% 13.200 10.560 N Eif4g3 n/a
3 TRCN0000328218 GGGCTCACCTTCCCGTTTAAA pLKO_005 2353 CDS 100% 15.000 10.500 N Eif4g3 n/a
4 TRCN0000328290 ACTACAAGCATCCATAGTAAA pLKO_005 5082 CDS 100% 13.200 9.240 N Eif4g3 n/a
5 TRCN0000328292 AGGTGATCATGGAGGATAAAG pLKO_005 5443 3UTR 100% 13.200 9.240 N Eif4g3 n/a
6 TRCN0000096818 CACTTGAGAAAGGCGGAGAAT pLKO.1 2719 CDS 100% 4.950 3.465 N Eif4g3 n/a
7 TRCN0000096817 CCAAGTCTATCATTGACGAAT pLKO.1 4220 CDS 100% 4.950 3.465 N Eif4g3 n/a
8 TRCN0000096815 CCTGAGAACTTGCCTTAGCAA pLKO.1 1917 CDS 100% 3.000 2.100 N Eif4g3 n/a
9 TRCN0000096814 CCTGGAACAAGGAAACAGCAA pLKO.1 5466 3UTR 100% 2.640 1.848 N Eif4g3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538795.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.