Transcript: Mouse XM_006538932.2

PREDICTED: Mus musculus chromodomain helicase DNA binding protein 5 (Chd5), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chd5 (269610)
Length:
9350
CDS:
300..6140

Additional Resources:

NCBI RefSeq record:
XM_006538932.2
NBCI Gene record:
Chd5 (269610)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235955 CAGCGCCAACAACCCGTTTAA pLKO_005 893 CDS 100% 13.200 18.480 N Chd5 n/a
2 TRCN0000235954 CGGACAACCAGTCGGAGTATT pLKO_005 4402 CDS 100% 13.200 18.480 N Chd5 n/a
3 TRCN0000235956 TTTGGTGTCCCTGCGTTTATG pLKO_005 8890 3UTR 100% 13.200 18.480 N Chd5 n/a
4 TRCN0000235953 ACCAGGTGTCTCTACTCAATA pLKO_005 3238 CDS 100% 13.200 9.240 N Chd5 n/a
5 TRCN0000235957 AGTACGAGGGCTACAAGTATG pLKO_005 3487 CDS 100% 10.800 7.560 N Chd5 n/a
6 TRCN0000021798 CGCAAGAAGAAGAGGATTGAT pLKO.1 1284 CDS 100% 5.625 3.938 N CHD5 n/a
7 TRCN0000140823 GAAGGAGAAGAAGGAGAAGGT pLKO.1 608 CDS 100% 2.640 1.320 Y PTMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.