Transcript: Mouse XM_006538987.1

PREDICTED: Mus musculus preferentially expressed antigen in melanoma like 4 (Pramel4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pramel4 (347710)
Length:
2263
CDS:
434..1486

Additional Resources:

NCBI RefSeq record:
XM_006538987.1
NBCI Gene record:
Pramel4 (347710)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538987.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272175 CCTACAGGAAGCCCGTATTAT pLKO_005 751 CDS 100% 15.000 7.500 Y Gm13102 n/a
2 TRCN0000281873 GGTCGTGGGATGGTGATATAT pLKO_005 1454 CDS 100% 15.000 7.500 Y Gm13102 n/a
3 TRCN0000281874 GTCCATACACTGGGATATATA pLKO_005 637 CDS 100% 15.000 7.500 Y Gm13102 n/a
4 TRCN0000284651 CAGGTCTCAAGAGATTCATTA pLKO_005 1701 3UTR 100% 13.200 6.600 Y Gm13102 n/a
5 TRCN0000270240 GAACCTACAAGTGCTTGATTT pLKO_005 277 5UTR 100% 13.200 6.600 Y Pramef6 n/a
6 TRCN0000179667 GCACCTGATGAAGTCTATGAT pLKO.1 1253 CDS 100% 5.625 2.813 Y Pramel4 n/a
7 TRCN0000179124 GCAGGTCTCAAGAGATTCATT pLKO.1 1700 3UTR 100% 5.625 2.813 Y Pramel4 n/a
8 TRCN0000202133 CCAAGCATCCATCAGCTCAAA pLKO.1 953 CDS 100% 4.950 2.475 Y Pramel4 n/a
9 TRCN0000192052 CCAGACAGATTTGTACAACTT pLKO.1 1292 CDS 100% 4.950 2.475 Y Pramel4 n/a
10 TRCN0000190385 CTCTTCCGAAGGTTAGAAGTT pLKO.1 1500 3UTR 100% 4.950 2.475 Y Pramel4 n/a
11 TRCN0000190992 CTTCCGAAGGTTAGAAGTTCA pLKO.1 1502 3UTR 100% 4.950 2.475 Y Pramel4 n/a
12 TRCN0000202412 GCTCTTCCGAAGGTTAGAAGT pLKO.1 1499 3UTR 100% 4.950 2.475 Y Pramel4 n/a
13 TRCN0000196167 GCATGGTATCTTCTGAGCCTT pLKO.1 1422 CDS 100% 2.640 1.320 Y Pramel4 n/a
14 TRCN0000201710 CCTGAAAGCTACAATGAGCTT pLKO.1 113 5UTR 100% 0.264 0.132 Y Pramel4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538987.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.