Transcript: Mouse XM_006539116.3

PREDICTED: Mus musculus Na+/K+ transporting ATPase interacting 1 (Nkain1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nkain1 (67149)
Length:
2578
CDS:
160..804

Additional Resources:

NCBI RefSeq record:
XM_006539116.3
NBCI Gene record:
Nkain1 (67149)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539116.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257948 CCGCAGAAGACGTCGCATTTA pLKO_005 754 CDS 100% 13.200 18.480 N Nkain1 n/a
2 TRCN0000141830 GAAGACGTCGCATTTACAGCT pLKO.1 759 CDS 100% 2.640 3.696 N NKAIN1 n/a
3 TRCN0000249987 CCAGCGGCAGATCTTCGATTT pLKO_005 246 CDS 100% 10.800 7.560 N Nkain1 n/a
4 TRCN0000175752 GCTCTACTCCTTACCTAGTAT pLKO.1 1113 3UTR 100% 5.625 3.938 N Nkain1 n/a
5 TRCN0000175587 CTTACATTGAAGCCCTCAGTA pLKO.1 608 CDS 100% 4.950 3.465 N Nkain1 n/a
6 TRCN0000249986 CACTGGCTGCCTGCTTGATTA pLKO_005 585 CDS 100% 13.200 7.920 N Nkain1 n/a
7 TRCN0000249988 GAATGAGAGTGGGTGACTATG pLKO_005 1921 3UTR 100% 10.800 6.480 N Nkain1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539116.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12568 pDONR223 100% 70.4% 76.1% None (many diffs) n/a
2 ccsbBroad304_12568 pLX_304 0% 70.4% 76.1% V5 (many diffs) n/a
3 TRCN0000469952 ACTACGCCCGTAATATCTTGTCGC pLX_317 87.5% 70.4% 76.1% V5 (many diffs) n/a
Download CSV