Transcript: Mouse XM_006539210.1

PREDICTED: Mus musculus ERBB receptor feedback inhibitor 1 (Errfi1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Errfi1 (74155)
Length:
3151
CDS:
379..1764

Additional Resources:

NCBI RefSeq record:
XM_006539210.1
NBCI Gene record:
Errfi1 (74155)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539210.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011927 CGGCCAGATCAACTATGCATA pLKO.1 990 CDS 100% 4.950 6.930 N Errfi1 n/a
2 TRCN0000273722 AGGTTAGCTCAACGCATTATT pLKO_005 1538 CDS 100% 15.000 12.000 N Errfi1 n/a
3 TRCN0000273770 CATACAGGCCTGCTCTATAAA pLKO_005 2216 3UTR 100% 15.000 10.500 N Errfi1 n/a
4 TRCN0000011925 CCACCGTACCTGGACAAATAT pLKO.1 1576 CDS 100% 15.000 10.500 N Errfi1 n/a
5 TRCN0000273773 CCACCGTACCTGGACAAATAT pLKO_005 1576 CDS 100% 15.000 10.500 N Errfi1 n/a
6 TRCN0000273720 CCTTGCATCCTGCCCATTATT pLKO_005 1504 CDS 100% 15.000 10.500 N Errfi1 n/a
7 TRCN0000273721 GCGTGAAGAGGATCAAGTTAT pLKO_005 690 CDS 100% 13.200 9.240 N Errfi1 n/a
8 TRCN0000011924 CCCAAGTATGTCAGCAGCAAA pLKO.1 1441 CDS 100% 4.950 3.465 N Errfi1 n/a
9 TRCN0000011926 CCTTCAGATTTCAAATACGAT pLKO.1 940 CDS 100% 3.000 2.100 N Errfi1 n/a
10 TRCN0000011923 CCGCCTTAATGAGAAAGGCTT pLKO.1 1872 3UTR 100% 0.264 0.185 N Errfi1 n/a
11 TRCN0000153335 GCAGATCTTAGCTGTGCATTT pLKO.1 1036 CDS 100% 10.800 6.480 N HERC2P3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539210.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.