Transcript: Mouse XM_006539447.3

PREDICTED: Mus musculus acid phosphatase 7, tartrate resistant (Acp7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acp7 (101744)
Length:
2192
CDS:
396..1886

Additional Resources:

NCBI RefSeq record:
XM_006539447.3
NBCI Gene record:
Acp7 (101744)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080675 GCGCTACAATTTCTCTAACTA pLKO.1 1193 CDS 100% 5.625 7.875 N Acp7 n/a
2 TRCN0000452784 ACAGATTTATGAGGCTCATTG pLKO_005 1120 CDS 100% 10.800 8.640 N Acp7 n/a
3 TRCN0000080677 CGGCCTATGTACTGTTCCAAT pLKO.1 1428 CDS 100% 4.950 3.960 N Acp7 n/a
4 TRCN0000080674 CCCAAGAGTATCCTCATGTTA pLKO.1 640 CDS 100% 5.625 3.938 N Acp7 n/a
5 TRCN0000080676 GCCTGCCCATATCATCTCATT pLKO.1 1274 CDS 100% 4.950 3.465 N Acp7 n/a
6 TRCN0000051299 CCAATTTACAACTACCAGGTA pLKO.1 1593 CDS 100% 2.640 1.848 N ACP7 n/a
7 TRCN0000080673 GTACCTCTTGTGAAGACACTT pLKO.1 1894 3UTR 100% 0.000 0.000 N Acp7 n/a
8 TRCN0000450073 ACTCGGATGCACATCCTTAAT pLKO_005 1761 CDS 100% 13.200 7.920 N Acp7 n/a
9 TRCN0000359839 GACCTCCAGAAAGCCAATAAG pLKO_005 1368 CDS 100% 13.200 7.920 N ACP7 n/a
10 TRCN0000440367 ACAACATGGACCAGGACAATG pLKO_005 1087 CDS 100% 10.800 6.480 N Acp7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10109 pDONR223 100% 72.5% 75.8% None (many diffs) n/a
2 ccsbBroad304_10109 pLX_304 0% 72.5% 75.8% V5 (many diffs) n/a
3 TRCN0000480326 TTCTGTCTCCTGTTCGATCCATGC pLX_317 27.5% 72.5% 75.8% V5 (many diffs) n/a
Download CSV