Transcript: Mouse XM_006539524.3

PREDICTED: Mus musculus dystrophia myotonica-containing WD repeat motif (Dmwd), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dmwd (13401)
Length:
2561
CDS:
181..2106

Additional Resources:

NCBI RefSeq record:
XM_006539524.3
NBCI Gene record:
Dmwd (13401)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539524.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173429 CCTGGCATACCATTCAGCATT pLKO.1 1624 CDS 100% 4.950 3.960 N Dmwd n/a
2 TRCN0000173138 CGTGTGCAAGAAGATTGCTCA pLKO.1 1869 CDS 100% 2.640 2.112 N Dmwd n/a
3 TRCN0000174883 GTTCTCTGAAACATCAGTGTT pLKO.1 2322 3UTR 100% 4.950 3.465 N Dmwd n/a
4 TRCN0000173226 CCACTTTGACAGCATGCTTCT pLKO.1 1032 CDS 100% 4.050 2.835 N Dmwd n/a
5 TRCN0000175390 CATCAAGAAAGACACCAGCAA pLKO.1 687 CDS 100% 2.640 1.848 N Dmwd n/a
6 TRCN0000173656 CATCGATCTCAACAAGCCCAT pLKO.1 543 CDS 100% 2.160 1.296 N Dmwd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539524.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10782 pDONR223 100% 43.2% 46.2% None (many diffs) n/a
2 ccsbBroad304_10782 pLX_304 0% 43.2% 46.2% V5 (many diffs) n/a
3 TRCN0000473830 ACATCAGTACCCCCGCAGATCGTC pLX_317 43.1% 43.2% 46.2% V5 (many diffs) n/a
Download CSV