Transcript: Mouse XM_006539529.3

PREDICTED: Mus musculus epsin 1 (Epn1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Epn1 (13854)
Length:
2429
CDS:
300..2030

Additional Resources:

NCBI RefSeq record:
XM_006539529.3
NBCI Gene record:
Epn1 (13854)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111702 CGTGTATCACAACAGTGCAAA pLKO.1 570 CDS 100% 4.950 6.930 N Epn1 n/a
2 TRCN0000111700 CCCTGGTGAATCCTTGGTGAT pLKO.1 2370 3UTR 100% 4.050 3.240 N Epn1 n/a
3 TRCN0000379960 TGATCTGGAAGCGGCTCAATG pLKO_005 475 CDS 100% 10.800 7.560 N EPN1 n/a
4 TRCN0000111703 GATGAAGAATATCGTCCACAA pLKO.1 326 CDS 100% 4.050 2.835 N Epn1 n/a
5 TRCN0000111704 CGCGCTCAAGACCAAGGAGAA pLKO.1 737 CDS 100% 1.350 0.945 N Epn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03105 pDONR223 100% 83.5% 90.6% None (many diffs) n/a
2 ccsbBroad304_03105 pLX_304 0% 83.5% 90.6% V5 (many diffs) n/a
3 TRCN0000475073 CTGGTATTAACACCGTTGCAGGCC pLX_317 25.8% 83.5% 90.6% V5 (many diffs) n/a
Download CSV