Transcript: Mouse XM_006539617.1

PREDICTED: Mus musculus numb-like (Numbl), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Numbl (18223)
Length:
2603
CDS:
176..1867

Additional Resources:

NCBI RefSeq record:
XM_006539617.1
NBCI Gene record:
Numbl (18223)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539617.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294446 CCATTTCACTGCCGGACTTAG pLKO_005 2088 3UTR 100% 10.800 15.120 N NUMBL n/a
2 TRCN0000105985 GCCCTCTGTTCAAGCTACTTT pLKO.1 2146 3UTR 100% 5.625 3.938 N Numbl n/a
3 TRCN0000325207 GCCCTCTGTTCAAGCTACTTT pLKO_005 2146 3UTR 100% 5.625 3.938 N Numbl n/a
4 TRCN0000105987 CACACAGATCAGCTCGTCTTT pLKO.1 1144 CDS 100% 4.950 3.465 N Numbl n/a
5 TRCN0000325204 CACACAGATCAGCTCGTCTTT pLKO_005 1144 CDS 100% 4.950 3.465 N Numbl n/a
6 TRCN0000105986 CAGTCAGAAGAACTCACCTTT pLKO.1 988 CDS 100% 4.950 3.465 N Numbl n/a
7 TRCN0000325206 CAGTCAGAAGAACTCACCTTT pLKO_005 988 CDS 100% 4.950 3.465 N Numbl n/a
8 TRCN0000105988 CTTGCAGAAGACCTTCGAGAT pLKO.1 1837 CDS 100% 4.050 2.835 N Numbl n/a
9 TRCN0000325125 CTTGCAGAAGACCTTCGAGAT pLKO_005 1837 CDS 100% 4.050 2.835 N Numbl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539617.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11353 pDONR223 100% 88.6% 95.7% None (many diffs) n/a
2 ccsbBroad304_11353 pLX_304 0% 88.6% 95.7% V5 (many diffs) n/a
3 TRCN0000469043 CCACTTATCCCCGACCGATTCTGC pLX_317 25.1% 88.6% 95.7% V5 (many diffs) n/a
Download CSV