Transcript: Mouse XM_006539637.2

PREDICTED: Mus musculus protein kinase C, gamma (Prkcg), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prkcg (18752)
Length:
3231
CDS:
1279..2466

Additional Resources:

NCBI RefSeq record:
XM_006539637.2
NBCI Gene record:
Prkcg (18752)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361366 ACGAGTTCTAGACGCTGTTTC pLKO_005 2598 3UTR 100% 10.800 15.120 N Prkcg n/a
2 TRCN0000022684 CGACGAACTCTATGCCATCAA pLKO.1 1491 CDS 100% 4.950 3.960 N Prkcg n/a
3 TRCN0000022687 CCAGGGCTTTACTTATGTGAA pLKO.1 2382 CDS 100% 4.950 3.465 N Prkcg n/a
4 TRCN0000022686 GCACCTGAGATCATTGCCTAT pLKO.1 1939 CDS 100% 4.050 2.835 N Prkcg n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3065 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14791 pDONR223 0% 49.9% 56% None (many diffs) n/a
2 ccsbBroad304_14791 pLX_304 0% 49.9% 56% V5 (many diffs) n/a
3 TRCN0000467072 CTGGAACAGATCCCTCCGACATAA pLX_317 17.9% 49.9% 56% V5 (many diffs) n/a
Download CSV