Transcript: Mouse XM_006540174.3

PREDICTED: Mus musculus coiled-coil domain containing 97 (Ccdc97), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc97 (52132)
Length:
3890
CDS:
1182..2009

Additional Resources:

NCBI RefSeq record:
XM_006540174.3
NBCI Gene record:
Ccdc97 (52132)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540174.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219462 GAAGACCAGAGGTCGGATAAA pLKO.1 1755 CDS 100% 13.200 18.480 N Ccdc97 n/a
2 TRCN0000219458 ACGGAGAGGAAGCCGGATAAT pLKO.1 879 5UTR 100% 13.200 9.240 N Ccdc97 n/a
3 TRCN0000219460 CTGCCCTCTGTATCAAGTAAA pLKO.1 3367 3UTR 100% 13.200 9.240 N Ccdc97 n/a
4 TRCN0000219459 TCCAAGGAGGCGAGTACTTTA pLKO.1 1483 CDS 100% 13.200 9.240 N Ccdc97 n/a
5 TRCN0000219461 ATGAGGAGGACCGGTACTTTG pLKO.1 1939 CDS 100% 10.800 7.560 N Ccdc97 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540174.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04511 pDONR223 100% 68.3% 72.3% None (many diffs) n/a
2 ccsbBroad304_04511 pLX_304 0% 68.3% 72.3% V5 (many diffs) n/a
3 TRCN0000492281 ATCGGACATTCGTAGATGATTCCG pLX_317 19.2% 68.3% 72.3% V5 (many diffs) n/a
Download CSV