Transcript: Mouse XM_006540227.1

PREDICTED: Mus musculus cleft lip and palate associated transmembrane protein 1 (Clptm1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clptm1 (56457)
Length:
2660
CDS:
522..2210

Additional Resources:

NCBI RefSeq record:
XM_006540227.1
NBCI Gene record:
Clptm1 (56457)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193689 CCACAGCTCTTCATCAACTAT pLKO.1 1788 CDS 100% 5.625 3.938 N Clptm1 n/a
2 TRCN0000176153 GCCCTCAACACTTTCATTGAT pLKO.1 1857 CDS 100% 5.625 3.938 N Clptm1 n/a
3 TRCN0000193704 CTCCTTTACATCCTGGACAAT pLKO.1 1434 CDS 100% 4.950 3.465 N Clptm1 n/a
4 TRCN0000175846 GCAGAATGGCTCCATCTATAT pLKO.1 692 CDS 100% 13.200 7.920 N Clptm1 n/a
5 TRCN0000175283 CAACACTTTCATTGATGACTT pLKO.1 1862 CDS 100% 4.950 2.970 N Clptm1 n/a
6 TRCN0000194221 GCTCCATCTATATCCATGTCT pLKO.1 700 CDS 100% 3.000 1.800 N Clptm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540227.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15386 pDONR223 0% 74.7% 80.4% None (many diffs) n/a
2 ccsbBroad304_15386 pLX_304 0% 74.7% 80.4% V5 (many diffs) n/a
3 ccsbBroadEn_06013 pDONR223 100% 72.2% 76.9% None (many diffs) n/a
4 ccsbBroad304_06013 pLX_304 0% 72.2% 76.9% V5 (many diffs) n/a
5 TRCN0000475068 CCAGGTAATGCTACACACGGGTTT pLX_317 15.5% 72.2% 76.9% V5 (many diffs) n/a
Download CSV