Transcript: Mouse XM_006540290.4

PREDICTED: Mus musculus RIKEN cDNA 2310022A10 gene (2310022A10Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
2310022A10Rik (66367)
Length:
2027
CDS:
183..1376

Additional Resources:

NCBI RefSeq record:
XM_006540290.4
NBCI Gene record:
2310022A10Rik (66367)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540290.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178202 CGCTGTGATGTTTGTGGATAA pLKO.1 344 CDS 100% 10.800 8.640 N 2310022A10Rik n/a
2 TRCN0000277445 CGCTGTGATGTTTGTGGATAA pLKO_005 344 CDS 100% 10.800 8.640 N 2310022A10Rik n/a
3 TRCN0000197968 GCATGCTGCTAGATCTTAATA pLKO.1 379 CDS 100% 15.000 10.500 N 2310022A10Rik n/a
4 TRCN0000277444 AGCATGCTGCTAGATCTTAAT pLKO_005 378 CDS 100% 13.200 9.240 N 2310022A10Rik n/a
5 TRCN0000177139 GCTGTGATGTTTGTGGATAAT pLKO.1 345 CDS 100% 13.200 9.240 N 2310022A10Rik n/a
6 TRCN0000197510 CATAGAACATCTGTGTTTGAT pLKO.1 858 CDS 100% 5.625 3.938 N 2310022A10Rik n/a
7 TRCN0000178543 GCGAACCTGTAAAGACTGTTA pLKO.1 1355 CDS 100% 4.950 3.465 N 2310022A10Rik n/a
8 TRCN0000277373 GCGAACCTGTAAAGACTGTTA pLKO_005 1355 CDS 100% 4.950 3.465 N 2310022A10Rik n/a
9 TRCN0000181641 GAAATCATGAACGAGCTGGGT pLKO.1 402 CDS 100% 0.660 0.462 N 2310022A10Rik n/a
10 TRCN0000198422 GATGGAGGGAAAGTACATCAT pLKO.1 767 CDS 100% 4.950 2.970 N 2310022A10Rik n/a
11 TRCN0000177808 CCTGGAACTTGCTATGTAGAT pLKO.1 1810 3UTR 100% 4.950 2.475 Y 2310022A10Rik n/a
12 TRCN0000286002 CCTGGAACTTGCTATGTAGAT pLKO_005 1810 3UTR 100% 4.950 2.475 Y 2310022A10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540290.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.